Blending shapes

[h.ozboluk]

1 minute ago, MKallas said:

It might be worth it. I arrived here in this thread because I searched Google for the same issue. Didn't realise it has been an issue for so long and the celebrated V2 still is lacking.
This is a major thing in my opinion. A total deal-breaker. At the moment, by coding and graphic design standards of, mildly put - 2022 -, without proper blend-morph Affinity Designer almost comes off like a browser based freeware. (Otherwise the program seems intuitive and runs good). I didn't want to mention it, but even Inkscape has robust blend effect slapped on.

eeeeexxxxaaaaaaaccccccctttttttlllllllllyyyyyy 

[Corgi]

Yes, it is hard to rationalize how Blend has been considered but not implemented for so long. Here is the roadmap from 2014, more than 8 years ago, and Blend is on here ... but at least some of these features are in v2, though!

[MKallas]

3 minutes ago, Corgi said:

Yes, it is hard to rationalize how Blend has been considered but not implemented for so long

Buddy, I don't know... It's categorized as "Usability", they might have referred to "blend mode" dropdown or something, not actual morph blend function. That replicate slash does not look right.

[debraspicher]

7 minutes ago, Corgi said:

[h.ozboluk]

Just now, debraspicher said:

at least them animals are cute,
but this matter robbed all my humor

[debraspicher]

2 minutes ago, h.ozboluk said:

at least them animals are cute,
but this matter robbed all my humor

It's a forum reference anyway. RIP Roadmap. We miss you.

[Corgi]

On 1/24/2018 at 11:22 AM, MEB said:

Hi Phil,

No, there's no Blend available in Designer. There a blend/replicate tool in Designer's roadmap but i don't know yet any details about it.

 

7 minutes ago, MKallas said:

Buddy, I don't know... It's categorized as "Usability", they might have referred to "blend mode" dropdown or something, not actual morph blend function. That replicate slash does not look right.

@MKallas, you might be right. Although that quote on the top from 2018 was from a moderator, and the roadmap at that time still listed Blend/Replicate under usability, yet he referred to it as a tool. Who knows.

[Colorwaves]

Those interested may wish to continue supporting the blend tool in the linked topic, as it is not in the archive and therefore also more explicitly related to V2.

 

[S1monSays]

To be honest, I was actually a little bit shocked when I found out that there is no morph/blend/tween function implemented in AD. I mean it's a fundamental function in all vector programs I encountered over the years: Aldus Freehand (later Adobe Freehand) had it, CorelDraw does, AI of course and even CAD packages offer it these days. What's worse is that people have apparently been telling Serif since 2015 that this function is a must. That's EIGHT YEARS!

I must say that I am sometimes truly baffled about the number of significant shortcomings in the designer application (array function, aligning objects along a curve (w/o the text path workaround), proper implementation of boolean functions (one that's not producing 2 useless shapes and 3 random artefacts when your cutting object is a closed topology), perspective adjustments of shapes/groups etc. are other known deficits that simply leave me speechless). I mean, that's just simple, basic stuff that's still not there!

Correct me if I am wrong but I am under the impression that the software is mostly being built by young programmers with no first-hand knowledge of the established workflows that are in place across the creative industry... if that's the case, then the product managers really need to up their game and start looking into an improved development process like the co-creation approach you find in the development of the Blender rendering/modelling application. (about me: industrial designer & design manager and team lead in the consumer industry for 25+ years).

When V2 came out, one of our designers yelled: "Designer V2 - now with basic functions that almost work!" (I understand the frustration, as management had forced the creative team to make the switch from Adobe to Affinity, promising them a mature product environment and a smooth workflow... yeah, right.)

Edited March 9 by S1monSays
Grammar/spelling errors, addtl. information.

[TJack]

I too would like to show my interest in a blend option to speed up workflow and create intricate transitions between shapes.