KennyLucius Posted January 9, 2022 Share Posted January 9, 2022 +1 for the blend tool. Having said that, Designer is an incredible value. It does much more than I expected of any Illustrator substitute. And I'm actually allowed to own it. And I'm not required to ignore the horde of subscription minions running the the background. I'm quite happy with Serif. Still, that blend tool is something I have never done without. barrycosta 1 Quote Link to comment Share on other sites More sharing options...
Ron P. Posted January 10, 2022 Share Posted January 10, 2022 I agree, this is a very powerful feature that would be nice if it was included in Designer. Quote Affinity Photo 2.4..; Affinity Designer 2.4..; Affinity Publisher 2.4..; Affinity2 Beta versions. Affinity Photo,Designer 1.10.6.1605 Win10 Home Version:21H2, Build: 19044.1766: Intel(R) Core(TM) i7-5820K CPU @ 3.30GHz, 3301 Mhz, 6 Core(s), 12 Logical Processor(s);32GB Ram, Nvidia GTX 3070, 3-Internal HDD (1 Crucial MX5000 1TB, 1-Crucial MX5000 500GB, 1-WD 1 TB), 4 External HDD Link to comment Share on other sites More sharing options...
cmyk Posted March 29, 2022 Share Posted March 29, 2022 Its 2022. No sign of a blend tool. Doh. Quote Link to comment Share on other sites More sharing options...
mimi123 Posted June 3, 2022 Share Posted June 3, 2022 +1 Quote Link to comment Share on other sites More sharing options...
Ian Bull Posted June 15, 2022 Share Posted June 15, 2022 I've just committed myself to Affinity Designer after over three decades of drawing vector artwork and I can hardly believe that there's no function for blending objects. Surely this is a basic function of vector software? I congratulate the developers on a magnificent product but without the ability to blend it's both left-wanting and, compared to the rivals, very much in the slow-lane. Blending really is a necessity and I urge that it's available as soon as possible. h.ozboluk and mimi123 1 1 Quote Link to comment Share on other sites More sharing options...
Pšenda Posted June 16, 2022 Share Posted June 16, 2022 On 6/15/2022 at 2:52 AM, Ian Bull said: Surely this is a basic function of vector software? For me no. Quote Affinity Store (MSI/EXE): Affinity Suite (ADe, APh, APu) 2.4.0.2301 Dell OptiPlex 7060, i5-8500 3.00 GHz, 16 GB, Intel UHD Graphics 630, Dell P2417H 1920 x 1080, Windows 11 Pro, Version 23H2, Build 22631.3155. Dell Latitude E5570, i5-6440HQ 2.60 GHz, 8 GB, Intel HD Graphics 530, 1920 x 1080, Windows 11 Pro, Version 23H2, Build 22631.3155. Intel NUC5PGYH, Pentium N3700 2.40 GHz, 8 GB, Intel HD Graphics, EIZO EV2456 1920 x 1200, Windows 10 Pro, Version 21H1, Build 19043.2130. Link to comment Share on other sites More sharing options...
UdoBerlin Posted June 23, 2022 Share Posted June 23, 2022 How would I do this in Affinity? https://blog.spoongraphics.co.uk/videos/colourful-3d-isometric-text-effect-illustrator-tutorial mimi123 1 Quote Link to comment Share on other sites More sharing options...
UdoBerlin Posted June 23, 2022 Share Posted June 23, 2022 But look at what he has to do in the first video from 3:55 to 6:34 (and most of it is sped up!). Guy in the second video just ignores the jagged edges, because this is much harder to do on the curved letters. Something we didn't have to do in FreeHand decades ago. deeds 1 Quote Link to comment Share on other sites More sharing options...
andren Posted July 20, 2022 Share Posted July 20, 2022 +1 This seems like a great feature. It would add an interesting element to certain designs. h.ozboluk 1 Quote Link to comment Share on other sites More sharing options...
barrycosta Posted July 20, 2022 Share Posted July 20, 2022 Would love to have a blend/morph tool for shapes. I miss having this from Illustrator for sure! The other being a trace of an object or image to create vectors. Still I love Affinity for what it offers. I hope they add this feature soon! h.ozboluk and MKallas 2 Quote Link to comment Share on other sites More sharing options...
Adri Wilde Posted October 7, 2022 Share Posted October 7, 2022 Would really like to see the blend tool to get integrated soon. Such a useful and powerful tool. mailmindflyer, MKallas and h.ozboluk 3 Quote Link to comment Share on other sites More sharing options...
1GR3 Posted November 10, 2022 Share Posted November 10, 2022 Unfortunately, no blend tool in v2 MKallas, baoyu, Geffish and 1 other 2 2 Quote Link to comment Share on other sites More sharing options...
MKallas Posted November 30, 2022 Share Posted November 30, 2022 (edited) Just started the trial with "cash in hand" to pay and it seems there is no Object nor Path blend tool. Unfortunately this is 100% deal breaker for me, for 95% of my vector work is dependent on vector steps blend - fabric textures and hair, no way doable by hand. Come on, guys! I really wish to move away from Adobe. You make it hard. To give an idea to the doubters, here's example of my work where half-tone vectors need to be blended and modified (theoretically in real time). Edited November 30, 2022 by MKallas debraspicher, h.ozboluk and François R 3 Quote Link to comment Share on other sites More sharing options...
Colorwaves Posted November 30, 2022 Share Posted November 30, 2022 +1 A blend-tool would be a great addition. Not only would it help create interesting structures faster, but its morphing ability would allow us to construct mediating shapes and curves that are just terribly time-consuming by hand. So I don't just want it, I need it! 😉 h.ozboluk 1 Quote Link to comment Share on other sites More sharing options...
debraspicher Posted November 30, 2022 Share Posted November 30, 2022 2 hours ago, MKallas said: Just started the trial with "cash in hand" to pay and it seems there is no Object nor Path blend tool. Unfortunately this is 100% deal breaker for me, for 95% of my vector work is dependent on vector steps blend - fabric textures and hair, no way doable by hand. Come on, guys! I really wish to move away from Adobe. You make it hard. To give an idea to the doubters, here's example of my work where half-tone vectors need to be blended and modified (theoretically in real time). Amazing work. I used to use Blend tool in AI to make textures like this. Powerful function to have. MKallas 1 Quote Link to comment Share on other sites More sharing options...
MKallas Posted November 30, 2022 Share Posted November 30, 2022 (edited) Quote debraspicherAmazing work. I used to use Blend tool in AI to make textures like this. Powerful function to have. Thank you, debraspicher! I don't want to spam my work here, since it is done using... *cough*Illustrator*cough* But if you check the project out here for example, imagine drawing every line by hand:https://www.behance.net/gallery/145661579/Social-Media-illustrations-for-lingerie-shop I got a bit edgy because someone in the beginning of the thread saying one is lazy if they need blend. I don't think so. Mathematically created vector is one of the reasons why vector entered graphic design in the first place! Averaging vectors in blend-morph is a MUST-HAVE. Without it I see Affinity Designer only as an amateur tool. Try failing at blend when business client asks 1000s of lines... Edited November 30, 2022 by MKallas debraspicher 1 Quote Link to comment Share on other sites More sharing options...
Colorwaves Posted November 30, 2022 Share Posted November 30, 2022 10 minutes ago, MKallas said: saying one is lazy if they need blend. Really nice illustrations! And I agree: the creative possibilities of the blend tool go far beyond the support of lazy contemporaries h.ozboluk 1 Quote Link to comment Share on other sites More sharing options...
KennyLucius Posted November 30, 2022 Share Posted November 30, 2022 (edited) 22 minutes ago, MKallas said: saying one is lazy if they need blend. It might be argued that anyone who has adopted tools newer than hammer/chisel is lazy. Hard to argue against that. Tool-users are taking the easy way out, aren't they? I could never do professional work without the blend tool. Charging hours without it would feel unethical. That said, AD is great for some non-billable things, and seems well worth the money. (But please give us a blend tool.) Edited November 30, 2022 by KennyLucius MKallas and Colorwaves 2 Quote Link to comment Share on other sites More sharing options...
debraspicher Posted November 30, 2022 Share Posted November 30, 2022 40 minutes ago, MKallas said: Thank you, debraspicher! I don't want to spam my work here, since it is done using... *cough*Illustrator*cough* But if you check the project out here for example, imagine drawing every line by hand:https://www.behance.net/gallery/145661579/Social-Media-illustrations-for-lingerie-shop I got a bit edgy because someone in the beginning of the thread saying one is lazy if they need blend. I don't think so. Mathematically created vector is one of the reasons why vector entered graphic design in the first place! Averaging vectors in blend-morph is a MUST-HAVE. Without it I see Affinity Designer only as an amateur tool. Try failing at blend when business client asks 1000s of lines... Oh yeah. That's why we're here. The work. Besides, the horse is out of the barn. Other apps have this functionality and so the bar is already raised. It's an industry and these are "industrial" tools in some sense. Like @KennyLucius mentioned, charging the hours would feel unethical, but it's a bit more than that. We have to compete against people using apps with highly optimized tools in their arsenal if we choose to go with Affinity. Blends have the "computerized" look anyway that is synonymous with the vector motif. It's unmistakable. I'm hoping because we got Warp that Blends won't be too far off. deeds, h.ozboluk, MKallas and 1 other 4 Quote Link to comment Share on other sites More sharing options...
MKallas Posted November 30, 2022 Share Posted November 30, 2022 The reality is even web browser rendered vectors can be averaged with JavaScript-JQuery, for instance (my main gig is front end design / coding actually). You sure have seen websites with morphing elements. Averaging vector is pretty standard motif in the wave of flat design. And it has been present for how long, a decade now? Affinity team, every blend between doesn't have to be editable and nodded vector straight away, even AI doesn't work this way before expanding. @KennyLucius, @debraspicher Yes, imagine charging for 20 hours drawing 100 perfect curves only to change them again. And then the next bloke does the same thing literally in 10 seconds. h.ozboluk and debraspicher 2 Quote Link to comment Share on other sites More sharing options...
h.ozboluk Posted November 30, 2022 Share Posted November 30, 2022 not AT ALL, I like your work too (there are some points that for my taste would need extra work, but good nonetheless), and it very good shows, that everyone who is waiting for the blending shapes functionality in affinity has a reason to demand it the only thing that bothers me is, wether this thread needs to be ported over to v2 feature requests in addition, because for my understanding any feature requests which were for v1 are ignored for v2 it would be great if moderators or staff would look into it, but since the new release my trust took a shooking too Colorwaves and MKallas 2 Quote Link to comment Share on other sites More sharing options...
Alfred Posted November 30, 2022 Share Posted November 30, 2022 28 minutes ago, debraspicher said: Besides, the horse is out of the barn. Other apps have this functionality and so the bar is already raised. DrawPlus, which was Serif’s previous (Windows only) hybrid vector/raster drawing application, has a very capable Blend Tool. h.ozboluk, debraspicher and MKallas 3 Quote Alfred Affinity Designer/Photo/Publisher 2 for Windows • Windows 10 Home/Pro Affinity Designer/Photo/Publisher 2 for iPad • iPadOS 17.4.1 (iPad 7th gen) Link to comment Share on other sites More sharing options...
MKallas Posted November 30, 2022 Share Posted November 30, 2022 (edited) 17 minutes ago, h.ozboluk said: the only thing that bothers me is, wether this thread needs to be ported over to v2 feature requests in addition, because for my understanding any feature requests which were for v1 are ignored for v2 it would be great if moderators or staff would look into it, but since the new release my trust took a shooking too It might be worth it. I arrived here in this thread only because I searched Google for the answer. Didn't realise it has been an issue for so long and the celebrated V2 still is lacking. This is a major thing in my opinion. A total deal-breaker. At the moment, by coding and graphic design standards of, mildly put - 2022 -, without proper blend-morph Affinity Designer almost comes off like a browser based freeware. (Otherwise the program seems intuitive and runs good). I didn't want to mention it, but even Inkscape has robust blend effect slapped on. Edited November 30, 2022 by MKallas h.ozboluk 1 Quote Link to comment Share on other sites More sharing options...
h.ozboluk Posted November 30, 2022 Share Posted November 30, 2022 4 minutes ago, Alfred said: DrawPlus, which was Serif’s previous (Windows only) hybrid vector/raster drawing application, has a very capable Blend Tool. good to know, so there are no excuses deeds, Alfred and MKallas 3 Quote Link to comment Share on other sites More sharing options...
h.ozboluk Posted November 30, 2022 Share Posted November 30, 2022 1 minute ago, MKallas said: It might be worth it. I arrived here in this thread because I searched Google for the same issue. Didn't realise it has been an issue for so long and the celebrated V2 still is lacking. This is a major thing in my opinion. A total deal-breaker. At the moment, by coding and graphic design standards of, mildly put - 2022 -, without proper blend-morph Affinity Designer almost comes off like a browser based freeware. (Otherwise the program seems intuitive and runs good). I didn't want to mention it, but even Inkscape has robust blend effect slapped on. eeeeexxxxaaaaaaaccccccctttttttlllllllllyyyyyy MKallas 1 Quote Link to comment Share on other sites More sharing options...
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.