h.ozboluk

2.1. Bummer.

Hey, we are aware of this feature request but I have little to no influence on when features may or may not be implemented by the developers.

can you please look in this too @Chris B, it seems this won't progress until some of the staff members are involved

it is a feature dearly needed by many creative artists and professionals alike 

myself I am waiting for this to be implemented into affinity designer since I first purchased it in 2018, were speaking five years now

and no, there are no other tools within the affinity software family that could emulate this feature

either way, if serif is not able or willing to supply its users with some of the most essential tools please say so, because there is no need to keep up false hopes if there is no intention whatsoever


best regards

can you please look in this too @Chris B, it seems this won't progress until some of the staff members are involved

it is a feature dearly needed by many creative artists and professionals alike 

myself I am waiting for this to be implemented into affinity designer since I first purchased it in 2018, were speaking five years now

and no, there are no other tools within the affinity software family that could emulate this feature

either way, if serif is not able or willing to supply its users with some of the most essential tools please say so, because there is no need to keep up false hopes if there is no intention whatsoever


best regards

very well with the new version 2.1 it seems the bug is gone for good, anyhow I will keep an open eye if it occurs again for any reason

see the attached screenshot

can you please look in this too @Chris B, it seems this won't progress until some of the staff members are involved

it is a feature dearly needed by many creative artists and professionals alike 

myself I am waiting for this to be implemented into affinity designer since I first purchased it in 2018, were speaking five years now

and no, there are no other tools within the affinity software family that could emulate this feature

either way, if serif is not able or willing to supply its users with some of the most essential tools please say so, because there is no need to keep up false hopes if there is no intention whatsoever


best regards

I ask for this tool since the beta period for version 1.0.
So, it goes back to 2014. That means that I have been asking for this tool for about 9 years now.
It was one of the tools that I used often, when I used FreeHand. And it was amazing. There are lots of things that can be acheived with this type of tool
I still have hope to see it implemented.
And I know that, is Serif implements it, it will make it excellent. Much better that in Illustrator or CorelDraw.
Come on, Serif!!!!
Like Picard says... MAKE IT SO. 

These old posts show that this is an old request:
 
And here is a video I made showing the Blend tool behaviour in FreeHand:
 
 

I’ll add my $0.02, largely echoing what’s already been said here and on other threads dating back quite a while:
The lack of a blend tool is a massive disappointment, and one of the basics I miss daily.
Sure, it can be achieved with other software and copy/pasted or imported, but that hurts Affinity achieve the perception of professional software they are aiming for today.
Having a minuscule knowledge of programming (used to edit PostScript files by hand in the previous millennia...) it does seem that adding this feature really wouldn’t be that difficult. Maybe the difficulty is greater than I imagine, and perhaps it’s already been addressed. But seeing that this was included in Illustrator since ~1996—and is so important to a professional workflow—I can’t see why this remains unobtainium in the Affinity suite.
Here's hoping this can doesn’t get kicked further down the road.
</soapbox>

Hi @h.ozboluk Yes I'm still following this and there has been a fix. We're just waiting for it to be pulled.

Violà, hope you still need it 🙂 Same for Designer, Photo and Publisher

The clear need for a blend tool is reinforced by the fact that given the complexity of such special requirements, even the most exotic affinity internal workarounds can usually not bring any relevant/efficient relief (except maybe for simple constructs). This is not a trivial "just know how" situation.

I too was disappointed to see this wasn't part of 2.0, but I'm hoping this fresh infusion of capital (from finally letting us support Designer again, some for the first time since 2014!) will allow Serif to staff up a bit more and build out some of these long-requested features (without taking another eight years).
Vector warp is huge, and it's so good to see it finally come to Designer. I hope the fact that even the hero image for the feature, which shows a field of stripes that you must currently create one at a time by hand, means a blend tool is in the works for 2.1!

good to know, so there are no excuses

Buddy, I don't know... It's categorized as "Usability", they might have referred to "blend mode" dropdown or something, not actual morph blend function. That replicate slash does not look right.

eeeeexxxxaaaaaaaccccccctttttttlllllllllyyyyyy 

good to know, so there are no excuses

good to know, so there are no excuses

It might be worth it. I arrived here in this thread only because I searched Google for the answer. Didn't realise it has been an issue for so long and the celebrated V2 still is lacking.
This is a major thing in my opinion. A total deal-breaker. At the moment, by coding and graphic design standards of, mildly put - 2022 -, without proper blend-morph Affinity Designer almost comes off like a browser based freeware. (Otherwise the program seems intuitive and runs good). I didn't want to mention it, but even Inkscape has robust blend effect slapped on.

DrawPlus, which was Serif’s previous (Windows only) hybrid vector/raster drawing application, has a very capable Blend Tool.

not AT ALL,
I like your work too (there are some points that for my taste would need extra work, but good nonetheless), 
and it very good shows, that everyone who is waiting for the blending shapes functionality in affinity has a reason to demand it

the only thing that bothers me is, wether this thread needs to be ported over to v2 feature requests in addition, because for my
understanding any feature requests which were for v1 are ignored for v2

it would be great if moderators or staff would look into it, but since the new release my trust took a shooking too
 

not AT ALL,
I like your work too (there are some points that for my taste would need extra work, but good nonetheless), 
and it very good shows, that everyone who is waiting for the blending shapes functionality in affinity has a reason to demand it

the only thing that bothers me is, wether this thread needs to be ported over to v2 feature requests in addition, because for my
understanding any feature requests which were for v1 are ignored for v2

it would be great if moderators or staff would look into it, but since the new release my trust took a shooking too
 

The reality is even web browser rendered vectors can be averaged with JavaScript-JQuery, for instance (my main gig is front end design / coding actually).
You sure have seen websites with morphing elements.
Averaging vector is pretty standard motif in the wave of flat design. And it has been present for how long, a decade now?
Affinity team, every blend between doesn't have to be editable and nodded vector straight away, even AI doesn't work this way before expanding.
@KennyLucius, @debraspicher Yes, imagine charging for 20 hours drawing 100 perfect curves only to change them again. And then the next bloke does the same thing literally in 10 seconds.

Really nice illustrations! And I agree: the creative possibilities of the blend tool go far beyond the support of lazy contemporaries